| Primary Identifier | MGI:7541204 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Fnip2 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A T-to-C nucleotide change was engineered in the 3' UTR (GRCm39:chr3:79364590A>G) using an sgRNA (targeting GATAAGTGATATGAATGTAT) and an ssODN template with CRISPR/Cas9 technology. This mutation represents a human T>C mutation (SNP rs2299007) in the 3' UTR that affects miR-181b-5p binding and is associated with metabolic and obesityârelated phenotypes. |
