|  Help  |  About  |  Contact Us

Allele : Wdr5<em1Tcp> WD repeat domain 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7516888 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, No functional change Gene  Wdr5
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TATTGCCCCTCTGCAGTGAA and GTGAGTGAGGTGAGATCCTA and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking four exons, ENSMUSE00001206138, ENSMUSE0000016411, ENSMUSE00000164106, and ENSMUSE00000164101 (GRCm39). The loxP sites are inserted after Chr2:27409637 and after Chr2:27411182. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories