| Primary Identifier | MGI:7516123 | Allele Type | Endonuclease-mediated |
| Gene | Ccnd3 | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Threonine codon 283 (ACT) in exon 7 was changed to alanine (GCT) (p.T283A) using an sgRNA (targeting GCTAGAGCCCCGGGGGGCTT) and an ssODN template with CRISPR/Cas9 technology. The mutation in the PEST domain of the encoded peptide, the equivalent of the human mutation associated with B cell non-Hodgkin lymphoma (B-NHL), replaces a phosphorylatable residue with a phosphoblocker and hyper-stabilizes the peptide. |
