|  Help  |  About  |  Contact Us

Allele : Ccnd3<em1Prad> cyclin D3; endonuclease-mediated mutation 1, Parham Ramezani-Rad

Primary Identifier  MGI:7516123 Allele Type  Endonuclease-mediated
Gene  Ccnd3 Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
molecularNote  Threonine codon 283 (ACT) in exon 7 was changed to alanine (GCT) (p.T283A) using an sgRNA (targeting GCTAGAGCCCCGGGGGGCTT) and an ssODN template with CRISPR/Cas9 technology. The mutation in the PEST domain of the encoded peptide, the equivalent of the human mutation associated with B cell non-Hodgkin lymphoma (B-NHL), replaces a phosphorylatable residue with a phosphoblocker and hyper-stabilizes the peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • Ccnd3<T283A>,
  • Ccnd3<T283A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele