|  Help  |  About  |  Contact Us

Allele : Cd274<em1Bajt> CD274 antigen; endonuclease-mediated mutation 1, Beth A Jiron Tamburini

Primary Identifier  MGI:7516359 Allele Type  Endonuclease-mediated
Gene  Cd274 Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  Threonine codon 277 (ACA) and serine codons 278 (AGC) and 279 (TCA) were changed to alanine (GCTGCAGCC) using an sgRNA (targeting ACAAGCTCAAAAAACCGAAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation changes three phosphorylatable residues in the cytoplasmic tail of the encoded peptide to phosphoblockers, disrupting chemokine signaling in dendritic cells.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Pdl1<CyMt>,
  • Pdl1<CyMt>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories