| Primary Identifier | MGI:7516359 | Allele Type | Endonuclease-mediated |
| Gene | Cd274 | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Threonine codon 277 (ACA) and serine codons 278 (AGC) and 279 (TCA) were changed to alanine (GCTGCAGCC) using an sgRNA (targeting ACAAGCTCAAAAAACCGAAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation changes three phosphorylatable residues in the cytoplasmic tail of the encoded peptide to phosphoblockers, disrupting chemokine signaling in dendritic cells. |