|  Help  |  About  |  Contact Us

Allele : Il10ra<em1Ccg> interleukin 10 receptor, alpha; endonuclease-mediated mutation 1, Christopher C Goodnow

Primary Identifier  MGI:7537039 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Il10ra
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Threonine codon 86 (ATA) in exon 3 was changed to isoleucine (ACA) (p.T86I) using an sgRNA (targeting GGTGAACGTTGTGAGATCACAGG) and an ssODN template with CRISPR/Cas9 technology. In this allele an unintended 8 bp deletion (TCACAGGA GRCm39:chr9:g.45177878_45177885) caused a frameshift and premature stop codon (p.C83Hfs*33).
  • mutations:
  • Single point mutation,
  • Intragenic deletion
  • synonyms:
  • Il10ra<KO>,
  • Il10ra<KO>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories