| Primary Identifier | MGI:7537039 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Il10ra |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Threonine codon 86 (ATA) in exon 3 was changed to isoleucine (ACA) (p.T86I) using an sgRNA (targeting GGTGAACGTTGTGAGATCACAGG) and an ssODN template with CRISPR/Cas9 technology. In this allele an unintended 8 bp deletion (TCACAGGA GRCm39:chr9:g.45177878_45177885) caused a frameshift and premature stop codon (p.C83Hfs*33). |
