| Primary Identifier | MGI:7529473 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ptpn22 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 620 (CGG) in exon 14 was changed to tryptophan (TGG) (p.R619W) using a crRNA (targeting AAGACTCGGGTGTCCGTTCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R620W mutation associated with multiple autoimmune disease. This allele was created in mice containing the Tg(TcraTcrb)1100Mjb and Ptpn22tm2.1Ciphe alleles. |
