|  Help  |  About  |  Contact Us

Allele : Ripk1<em1Dov> receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 1, Domagoj Vucic

Primary Identifier  MGI:7547311 Allele Type  Endonuclease-mediated
Gene  Ripk1 Is Recombinase  false
Is Wild Type  false
molecularNote  Lysine codon 115 (AAA) in exon 4 was changed to arginine (CGA) (p.K115R) using an sgRNA (targeting GAAAGGAAGGATAATCGTGG) and an ssODN template using CRISPR/Cas9 technology. The mutation affects ubiquination at the residue in the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Ripk1<K115R>,
  • Ripk1<K115R>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories