| Primary Identifier | MGI:7549276 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prkd2 |
| Inheritance Mode | Semidominant | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Tryptophan codon 807 (TGG) in exon 17 was targeted for change to arginine (AGG) (p.W807R) using an sgRNA (targeting TCTCAGCCACCCATGGTTAC) and an ssODN template with CRISPR/Cas9 technology. This allele represents an unintended 7 bp deletion (TACAGGT) of the last 5 bp of exon 17 and the first 2 bp of intron 17, which includes nucleotides from the last two codons of exon 17 (L and Q codons) and the core splice donor site. |
