|  Help  |  About  |  Contact Us

Allele : Prkd2<em2Btlr> protein kinase D2; endonuclease-mediated mutation 2, Bruce Beutler

Primary Identifier  MGI:7549276 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prkd2
Inheritance Mode  Semidominant Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Tryptophan codon 807 (TGG) in exon 17 was targeted for change to arginine (AGG) (p.W807R) using an sgRNA (targeting TCTCAGCCACCCATGGTTAC) and an ssODN template with CRISPR/Cas9 technology. This allele represents an unintended 7 bp deletion (TACAGGT) of the last 5 bp of exon 17 and the first 2 bp of intron 17, which includes nucleotides from the last two codons of exon 17 (L and Q codons) and the core splice donor site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele