|  Help  |  About  |  Contact Us

Allele : Mical1<em1Mean> microtubule associated monooxygenase, calponin and LIM domain containing 1; endonuclease-mediated mutation 1, Mark E Anderson

Primary Identifier  MGI:7628183 Allele Type  Endonuclease-mediated
Gene  Mical1 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Alanine codon 116 (CGT) in exon 3 was changed to histidine (CAT) (p.R116H) using an sgRNA (equivalent to AAAAGCGTATCAAGTTCTCTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide unable to support F-actin depolymerization, while its ability to accelerate NADPH oxidation in the presence of Camk2 is unaffected.
  • mutations:
  • Single point mutation
  • synonyms:
  • MICAL1<R116H>,
  • MICAL1<R116H>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories