| Primary Identifier | MGI:7628183 | Allele Type | Endonuclease-mediated |
| Gene | Mical1 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Alanine codon 116 (CGT) in exon 3 was changed to histidine (CAT) (p.R116H) using an sgRNA (equivalent to AAAAGCGTATCAAGTTCTCTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide unable to support F-actin depolymerization, while its ability to accelerate NADPH oxidation in the presence of Camk2 is unaffected. |