| Primary Identifier | MGI:7572887 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tnfrsf1a |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Threonine exon 79 (ACA) in exon 3 was changed to methionine (ATG) (p.T79M) using a crRNA (targeting CAGGGCGGGATACAGTCTGCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS). |