| Primary Identifier | MGI:7572889 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tnfrsf1a |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine exon 87 (GGC) in exon 3 was changed to valine (GTG) (p.G87V) using a crRNA (targeting GTCTGCAGGGAGTGTGAAAAGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS). |