| Primary Identifier | MGI:7574150 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Myh11 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Lysine codon 1256 (or 1257, 1258, 1259) (AAG) in exon 28 was deleted (p.K1256del) using gRNAs (targeting CCAGGCGAAGCAGGAGGTGGAAC and CCTGCAGCTGCACCTCCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with familial thoracic aortic aneurysms and dissections (FTAAD). |
