|  Help  |  About  |  Contact Us

Allele : Myh11<em1Yaim> myosin, heavy polypeptide 11, smooth muscle; endonuclease-mediated mutation 1, Yasushi Imai

Primary Identifier  MGI:7574150 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Myh11
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Lysine codon 1256 (or 1257, 1258, 1259) (AAG) in exon 28 was deleted (p.K1256del) using gRNAs (targeting CCAGGCGAAGCAGGAGGTGGAAC and CCTGCAGCTGCACCTCCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with familial thoracic aortic aneurysms and dissections (FTAAD).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Myh11<deltaK>,
  • Myh11<deltaK>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele