| Primary Identifier | MGI:7572890 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tnfrsf1a |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Threonine exon 90 (ACG) in exon 3 was changed to isoleucine (ATA) (p.T90I) using a crRNA (targeting CCTTTACGGCTTCCCAGAATTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation with unknown significance in relation to tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS). |
