| Primary Identifier | MGI:7608105 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Cdc23 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tyrosine codon 329 (TAC) in exon 9 was changed to cysteine (TGC) (p.Y329C) using an sgRNA (targeting GGTATTTATCAATTTCACAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility characterized by oocyte maturation defects. |