|  Help  |  About  |  Contact Us

Allele : Cdc23<em1Lwa> CDC23 cell division cycle 23; endonuclease-mediated mutation 1, Lei Wang

Primary Identifier  MGI:7608105 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Cdc23
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Tyrosine codon 329 (TAC) in exon 9 was changed to cysteine (TGC) (p.Y329C) using an sgRNA (targeting GGTATTTATCAATTTCACAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility characterized by oocyte maturation defects.
  • mutations:
  • Single point mutation
  • synonyms:
  • Cdc23<Y329C>,
  • Cdc23<Y329C>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories