|  Help  |  About  |  Contact Us

Allele : Wee2<em3(IMPC)J> WEE1 homolog 2 (S. pombe); endonuclease-mediated mutation 3, Jackson
Primary Identifier  MGI:7576991 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wee2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CGGCCATCTCAGTGCAGACA and CCGTGGGACATCCTCCGTGT. This resulted in a 21,994 bp deletion of Chr6:40,443,966-40,465,959 (GRCm38/mm10) removing exons ENSMUSE00000266547, ENSMUSE00000266539, ENSMUSE00000416138, ENSMUSE00000266530, ENSMUSE00000266525, ENSMUSE00000266519, ENSMUSE00000266519, ENSMUSE00000266506, ENSMUSE00000266499, ENSMUSE00000266493, ENSMUSE00000266485 (exons 2-12) that contain the entire protein coding sequence.
  • mutations:
  • Intragenic deletion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories





MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom