|  Help  |  About  |  Contact Us

Allele : Kdm2b<em1Xuwu> lysine (K)-specific demethylase 2B; endonuclease-mediated mutation 1, Xudong Wu

Primary Identifier  MGI:7578911 Allele Type  Endonuclease-mediated
Gene  Kdm2b Is Recombinase  false
Is Wild Type  false
molecularNote  Histidine codon 283 (CAT) in exon 9 was changed to alanine (GCT) (p.H283A) using an sgRNA (targeting TGGACTCTCTGGTGTTCGGC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide catalytically inactive.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Kdm2b-H283A,
  • Kdm2b-H283A
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories