| Primary Identifier | MGI:7623838 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Spo11 |
| Strain of Origin | (FVB/NJ x B6(Cg)-Tyr<c-2J>/J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Proline codon 306 (CCA) in exon 11 was changed to threonine (ACA) (p.P306T) using an sgRNA (corresponding to GACCAAGCCATCTGATTGTT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation, represented by SNP rs185545661. |
