|  Help  |  About  |  Contact Us

Allele : Spo11<em1Jcs> SPO11 initiator of meiotic double stranded breaks; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:7623838 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Spo11
Strain of Origin  (FVB/NJ x B6(Cg)-Tyr<c-2J>/J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 306 (CCA) in exon 11 was changed to threonine (ACA) (p.P306T) using an sgRNA (corresponding to GACCAAGCCATCTGATTGTT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation, represented by SNP rs185545661.
  • mutations:
  • Single point mutation
  • synonyms:
  • Spo11<P306T>,
  • Spo11<P306T>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele