| Primary Identifier | MGI:7616768 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc157 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology using gRNAs CTCTGAGAGCGGCCTATGGTGGG and GGGAGGATCCATCCAACCTAGGG generated a 4985 bp deletion and an 11 bp insertion, resulting in deletion of exons 4 to 9. Western blot analysis confirmed the absence of protein in testes extracts from homozygotes. |