|  Help  |  About  |  Contact Us

Allele : Ccdc157<em1Ymxi> coiled-coil domain containing 157; endonuclease-mediated mutation 1, Yongmei Xi

Primary Identifier  MGI:7616768 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc157
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology using gRNAs CTCTGAGAGCGGCCTATGGTGGG and GGGAGGATCCATCCAACCTAGGG generated a 4985 bp deletion and an 11 bp insertion, resulting in deletion of exons 4 to 9. Western blot analysis confirmed the absence of protein in testes extracts from homozygotes.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele