|  Help  |  About  |  Contact Us

Allele : N4bp1<em2Vmd> NEDD4 binding protein 1; endonuclease-mediated mutation 2, Vishva M Dixit

Primary Identifier  MGI:7641928 Allele Type  Endonuclease-mediated
Gene  N4bp1 Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  Aspartic acid codon 621 (GAT) in exon 2 was changed to alanine (GCC) (p.D621A) using an sgRNA (CUGGAAUUAAAAAACGAACC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the RNase activity of the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • N4bp1<D621A>,
  • N4bp1<D621A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories