| Primary Identifier | MGI:7641928 | Allele Type | Endonuclease-mediated |
| Gene | N4bp1 | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Aspartic acid codon 621 (GAT) in exon 2 was changed to alanine (GCC) (p.D621A) using an sgRNA (CUGGAAUUAAAAAACGAACC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the RNase activity of the encoded peptide. |