| Primary Identifier | MGI:7641929 | Allele Type | Endonuclease-mediated |
| Gene | N4bp1 | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Isoleucine codon 861 (ATC), phenylalanine codon 862 (TTC) and proline codon 863 (CCT) in exon 7 were changed to alanine (GCC) (p.I861_P863AdelIFPinsAAA) using an sgRNA (CAGCGCCUCCCUCAGCUCGC) and an ssODN template with CRISPR/Cas9 technology. The mutation eliminates the ubiquitin-binding activity of the encoded peptide. |