| Primary Identifier | MGI:7645530 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Helq |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glutamine codon 161 (CAA) in exon 2 was changed to proline (CCT) (p.Q161P) using an sgRNA (equivalent to AAGTATAAAATTTGAGAAGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.596 A>C; p.Q199P mutation associated with disrupted ovarian function (primary/premature ovarian insufficiency, POI) and female infertility. |
