|  Help  |  About  |  Contact Us

Allele : Helq<em1Eljt> helicase, POLQ-like; endonuclease-mediated mutation 1, Elena J Tucker

Primary Identifier  MGI:7645530 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Helq
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Glutamine codon 161 (CAA) in exon 2 was changed to proline (CCT) (p.Q161P) using an sgRNA (equivalent to AAGTATAAAATTTGAGAAGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.596 A>C; p.Q199P mutation associated with disrupted ovarian function (primary/premature ovarian insufficiency, POI) and female infertility.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Helq<KI>,
  • Helq<KI>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele