|  Help  |  About  |  Contact Us

Allele : Zbtb21<em1(IMPC)J> zinc finger and BTB domain containing 21; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7703526 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zbtb21
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATGAGCAGACACACAATTAA and CAGATAAAGTGCAGGATGGA. This resulted in a 3,196 bp deletion of Chr16:97,949,884-97,953,079 (GRCm38/mm10) that removes exon ENSMUSE00001260606.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories