|  Help  |  About  |  Contact Us

Allele : Lyve1<em1(cre/ERT2)Jkpns> lymphatic vessel endothelial hyaluronan receptor 1; endonuclease-mediated mutation 1, Jonathan Kipnis

Primary Identifier  MGI:7859688 Allele Type  Endonuclease-mediated
Attribute String  Inducible, Recombinase Gene  Lyve1
Strain of Origin  C57BL/6J Induced With  tamoxifen
Is Recombinase  true Is Wild Type  false
molecularNote  Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (GAAGTTTAGATGCAAGAGAGTGG) was used to introduce a cre/ERT2 fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) fused to a P2A self-cleaving peptide immediately upstream of the 3' UTR of the lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1) gene on chromosome 7.
  • mutations:
  • Insertion
  • synonyms:
  • Lyve1<creERT2>,
  • Lyve1<creERT2>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

1 Driven By

3 Publication categories