| Primary Identifier | MGI:7859686 | Allele Type | Endonuclease-mediated |
| Attribute String | Inducible, Recombinase | Gene | Mrc1 |
| Strain of Origin | C57BL/6J | Induced With | tamoxifen |
| Is Recombinase | true | Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (AGAAGCCTCATGGCCCAGAGTGG) was used to introduce a cre/ERT2 fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) fused to a P2A self-cleaving peptide between the 5' UTR and exon 1 of the mannose receptor, C type 1 (Mrc1) gene on chromosome 2. |
